MINHA CONTA

Endereço de e-mail

Senha

ESCOLHA A OPÇÃO BOLETO

PARA PAGAR SÓ DEPOIS DO RECEBIMENTO

NAS NOTAS PARA A FAPESP

A ISENÇÃO DE ICMS SERÁ CONFIRMADA POR E-MAIL

INFORME DADOS DO PROJETO

NO CAMPO DE OBSERVAÇÕES DO PEDIDO

 

O valor do frete será somado ao valor dos itens e não estará descrito na nota fiscal.

 

cDNA / RT-PCR

Kits para Síntese de cDNA

First Strand (Fita Simples)

Platus Transcriber RNase H- cDNA First Strand kit - Sinapse Inc - S1402

Platus Transcriber RNase H- cDNA First Strand kit - Sinapse Inc - S1402

(S1402)

Marca:  Sinapse Inc  | 

Embalagem:  100 x 20 uL rxns

Prazo de Entrega: 5-8 dias úteis

mais informações

Platus Transcriber RNase H- cDNA First Strand kit - Sinapse Inc - S1402

(S1402)

Marca:  Sinapse Inc  | 

Embalagem:  100 x 20 uL rxns

Prazo de Entrega: 5-8 dias úteis

mais informações

As combinações acima não possuem estoque.

por: R$ 1.900,00

Quantidade

+

-

COMPRAR

Ver outras formas de pagamento e parcelamento

Descrição do Produto

Sistema completo para a síntese de primeira cadeia de cDNA a partir de mRNA ou RNA total de até 13kb


Acompanha inibidor de Rnase;
Kit completo com oligo(dT)18 e Random Primers.
Ausência de atividade RNase H;
Eficiente para transcrição de RNA com elevado grau de estrutura secundária.

 

 

COMPONENTES DO KIT

 

Platus Transcriber RNase H- cDNA First Strand kit

100 reações

H Minus Transcriptase Reversa (200 U*/µL)

120 µL

Inibidores de RNase (20 U**/µL)

120 µL

5X Tampão de Reação

250 mM Tris-HCl (pH 8.3), 250 mM KCl, 20 mM MgCl2, 50 mM DTT

500 µL

10mM dNTP Mix

250 µL

Oligo(dT)18 Primer

100 µM, 0.5 µg/µL (15 A260 U/mL)

120 µL

Random Hexamer Primer

100 µM, 0.2 µg/µL (6 A260 U/mL)

120 µL

Forward GAPDH Primer, 10 µM

5’ – CAAGGTCATCCATGACAACTTTG – 3’

20 µL

Reverse GAPDH Primer, 10 µM

5’ – GTCCACCACCCTGTTGCTGTAG - 3’

20 µL

Controle GAPDH RNA

1.3 kb 3’-poly(A) tailed RNA transcript, 0.05 µg/µL

20 µL

Água livre de nucleases

2 x 1.25 mL

PRODUTOS RELACIONADOS

Produtos Relacionados